Abstract : Adulteration of wild boar and pig meat products with other animal meat is a sensitive issue especially in Indonesia as a moslem country. Due to Economically Motivated Adulteration (EMA), adulterated halal meat products with wild boar and pig meat had raised widespread concern in recent years. Limited study of PCR-DNA-Based to discriminate between domestic pig and wild boar. The aim of this study to design species specific primer to determine wild boar in cytochrome-B gen region. Total 7 animals DNA (Wild boar, Pig, Cow, Sheep, Goat, Chicken, Fish) were extracted. Both conventional and Real Time PCR were applied for qualitative and quantitative identification. Cytochrome-b gen of wild boar and pig were sequenced and primer were designed based on cytochrome-B sequencing through PrimeQuest software (https://www.idtdna.com) website. Designed primer were characterized by four criteria such as specificity, sensitivity, limit detection, and repetition test. The set of primers were designed for amplification consisted of Cyt-B Forward-171 5’CGAGACGTAAATTACGGATGAC’3 and Reverse-488 5’GGTAATGATGAAGGGCAGGATG’3. The results of this study showed the primer amplificated wild boar DNA specifically with annealing temperature 53oC, runed in 25 cycles RT-PCR system. Sensitivity test illustrated good recommendation (R2 0,9817; slope -3,4742; y-intercept 30,625; and Efficiency 94%). In conclusion, designed primer can detect adulteration of wild boar meat in food products. By the evidence of qualitative and quantitative test, designed primer can be applied for wild boar detection in commercial market products.